Journal: iScience
Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects
doi: 10.1016/j.isci.2023.106428
Figure Lengend Snippet: Key resources table
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .
Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software
tiangen biotech co manufactures this product 
